Genetic Homeland DNA Marker List for chromosome X

DNA Marker Index data
Marker Name(s) (separated with a single space)	Notes	Identification	Ancestral⁷	Derived⁸	Chromosome	Position (hg38)¹	Position (hg19)²
i5003044 rs111033627		SNPedia	C	T	X	124370177	123504027
i5900495 rs111033626		SNPedia	C	T	X	124370276	123504126
i5003046 rs111033624		SNPedia	G	C	X	124346737	123480587
i5003042 rs111033630		SNPedia	G	T	X	124365787	123499637
i5003047 rs111033628		SNPedia	C	T	X	124365795	123499645
i5007022 rs398122990		SNPedia	A	G	X	139541073	138623232
i5900852 rs267608617		SNPedia	CTCTGGGCATCTTCTCCTCTTTGCAGA	C	X	154030567	153296018
i5008445 rs137852333		SNPedia	G	A	X	154532797	153761012
i5008420 rs137852313		SNPedia	C	T	X	154535187	153763402
i5008463 rs137852349		SNPedia	A	G	X	154535996	153764211

Links for more information

DNA Pedigree by SNP Markers
Marker & Branch Count by Haplogroup
ISOGG Tree page which (at bottom of page) includes a list of the SNP marker prefixes and the entity which published those markers.
DNA Mapping Projects
ISOGG YBrowse tool
ISOGG Y-DNA Hapogroup Tree
ISOGG Index of FTDNA FT-- series markers from Big Y-700 testing.
YFull Y Tree
FTDNA Public Y-DNA Haplotree
23mofang Y Tree Y 遗传标记树
YTree.Net mutations by Alex Williamson. Focused on R-P312 and subbranches.
Irish Type III Website with authoritative list of DC marker series by Dennis Wright
YFull MtDNA Tree
SNPedia.com database for any chromosome
Ancient DNA on Indo-European.eu by Carlos Quiles (and formerly Jean Manco)
Legacy Y-STR Marker Conversion Notes
Geographic Map Site Index