Genetic Homeland DNA Marker List for chromosome 3

DNA Marker Index data
Marker Name(s) (separated with a single space)	Notes	Identification	Ancestral⁷	Derived⁸	Chromosome	Position (hg38)¹	Position (hg19)²
i3003626 rs333		SNPedia	TACAGTCAGTATCAATTCTGGAAGAATTTCCAG	T	3	46373452	46414943
i3003391 rs5030821		SNPedia	G	A,C	3	10149823	10191507
i5006373 rs104893825		SNPedia	G	T	3	10149819	10191503
i5006371 rs119103277		SNPedia	G	A,C	3	10142110	10183794
i3003389 rs5030818		SNPedia	C	G,T	3	10149804	10191488
i3003387 rs5030808		SNPedia	G	A,C,T	3	10142124	10183808
i5006379 rs104893831		SNPedia	G	A,T	3	10146549	10188233
i3003392 rs5030823		SNPedia	C	A,G,T	3	10149871	10191555
i5008106 rs80338799		SNPedia	G	A,C	3	12585745	12627244
i5008105 rs121434594		SNPedia	G	A,C,T	3	12604189	12645688

Links for more information

DNA Pedigree by SNP Markers
Marker & Branch Count by Haplogroup
ISOGG Tree page which (at bottom of page) includes a list of the SNP marker prefixes and the entity which published those markers.
DNA Mapping Projects
ISOGG YBrowse tool
ISOGG Y-DNA Hapogroup Tree
ISOGG Index of FTDNA FT-- series markers from Big Y-700 testing.
YFull Y Tree
FTDNA Public Y-DNA Haplotree
23mofang Y Tree Y 遗传标记树
YTree.Net mutations by Alex Williamson. Focused on R-P312 and subbranches.
Irish Type III Website with authoritative list of DC marker series by Dennis Wright
YFull MtDNA Tree
SNPedia.com database for any chromosome
Ancient DNA on Indo-European.eu by Carlos Quiles (and formerly Jean Manco)
Legacy Y-STR Marker Conversion Notes
Geographic Map Site Index