Genetic Homeland DNA Marker Index for FTF67245 on Y chromosome

DNA Marker Index information for Chromosome: Y Marker: FTF67245
Names and Aliases for this DNA Marker: FTF67245.
Chromosome Position in hg38 Human Genome assembly¹: 7516818.
Chromosome Position in hg19 assembly²: 7384859 .
Ancestral marker allele value: GCTACAACAAAAGGCCTTAGCCT.
Derived, alternative, or mutated marker allele value: del.

DNA Marker Index data for Marker: FTF67245 on Chromosome: Y
Marker Name(s) (separated with a single space)	Notes	Identification	Ancestral⁷	Derived⁸	Chromosome	Position (hg38)¹	Position (hg19)²
E-FTF67245 FTF67245	Found in haplogroup E-FTF67245. Deletion of 23 bp. DNA lineage FTF67245 is estimated to have originated in about the year 13,900 bce based on its position in the phylogenetic tree. Phylogenetic Parent: Y219789 View Ancestry	FTDNA 2024	GCTACAACAAAAGGCCTTAGCCT	del	Y	7516818	7384859

Links for more information

DNA Pedigree by SNP Markers
Marker & Branch Count by Haplogroup
ISOGG Tree page which (at bottom of page) includes a list of the SNP marker prefixes and the entity which published those markers.
DNA Mapping Projects
ISOGG YBrowse tool
ISOGG Y-DNA Hapogroup Tree
ISOGG Index of FTDNA FT-- series markers from Big Y-700 testing.
YFull Y Tree
FTDNA Public Y-DNA Haplotree
23mofang Y Tree Y 遗传标记树
YTree.Net mutations by Alex Williamson. Focused on R-P312 and subbranches.
Irish Type III Website with authoritative list of DC marker series by Dennis Wright
YFull MtDNA Tree
SNPedia.com database for any chromosome
Ancient DNA on Indo-European.eu by Carlos Quiles (and formerly Jean Manco)
Legacy Y-STR Marker Conversion Notes
Geographic Map Site Index

DNA Marker Index data for Marker: FTF67245 on Chromosome: Y

Links for more information

Problem: HTML 5 Local Storage blocked by your Web Browser.

Access to this content requires browser Local Storage capability.