DNA Marker Index data for Chromosome: 9
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 9 102762290 100000008 rs1266124701 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802111
RSID SNP 9 102762293 100000011 rs561582183 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802114
RSID SNP 9 102762294 100000012 rs1215922723 AC A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802115
RSID SNP 9 10000002 10000002 rs529881911 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990002
RSID SNP 9 102762305 100000023 rs1306099246 G A,C,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802126
RSID SNP 9 102762310 100000028 rs1204522789 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802131
RSID SNP 9 102762311 100000029 rs1052198981 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802132
RSID SNP 9 102762313 100000031 rs759042879 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802134
RSID SNP 9 102762314 100000032 rs1252393154 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802135
RSID SNP 9 102762317 100000035 rs983652451 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802138
RSID SNP 9 102762321 100000039 rs1369565218 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802142
RSID SNP 9 102762326 100000044 rs1481666608 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802147
RSID SNP 9 102762329 100000047 rs1293624257 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802150
RSID SNP 9 102762332 100000050 rs1418532145 AG A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802153
RSID SNP 9 102762341 100000059 rs545600522 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802162
RSID SNP 9 10000006 10000006 rs56084572 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990006
RSID SNP 9 102762348 100000066 rs907710467 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802169
RSID SNP 9 10000007 10000007 rs58245341 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990007
RSID SNP 9 102762352 100000070 rs1208736172 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802173
RSID SNP 9 102762363 100000081 rs1420767590 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802184
RSID SNP 9 102762364 100000082 rs766946602 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802185
RSID SNP 9 102762366 100000084 rs1037600777 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802187
RSID SNP 9 102762370 100000088 rs1197131818 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802191
RSID SNP 9 102762374 100000092 rs1435446681 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802195
RSID SNP 9 1000001 1000001 rs776223921 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 990001
RSID SNP 9 10000010 10000010 rs1330216714 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990010
RSID SNP 9 102762400 100000118 rs1243921313 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802221
RSID SNP 9 102762407 100000125 rs1268620521 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802228
RSID SNP 9 102762410 100000128 rs927237421 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802231
RSID SNP 9 102762426 100000144 rs937330163 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802247
RSID SNP 9 102762433 100000151 rs1057172618 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802254
RSID SNP 9 102762435 100000153 rs1344494949 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802256
RSID SNP 9 102762436 100000154 rs530674039 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802257
RSID SNP 9 102762448 100000166 rs1010328479 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802269
RSID SNP 9 102762449 100000167 rs1003500525 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802270
RSID SNP 9 102762450 100000168 rs752645711 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802271
RSID SNP 9 10000017 10000017 rs1470517932 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990017
RSID SNP 9 102762457 100000175 rs1283827877 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802278
RSID SNP 9 102762472 100000190 rs551183626 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802293
RSID SNP 9 102762478 100000196 rs1398916173 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802299
RSID SNP 9 102762479 100000197 rs1373513563 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802300
RSID SNP 9 102762490 100000208 rs548112803 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802311
RSID SNP 9 102762493 100000211 rs1431107045 CA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802314
RSID SNP 9 102762501 100000219 rs1310494577 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802322
RSID SNP 9 102762503 100000221 rs1382451638 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802324
RSID SNP 9 102762527 100000245 rs1374301559 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802348
RSID SNP 9 102762528 100000246 rs1042248884 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802349
RSID SNP 9 102762535 100000253 rs904709516 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802356
RSID SNP 9 10000026 10000026 rs1408689093 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990026
RSID SNP 9 102762548 100000266 rs1000388099 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802369
RSID SNP 9 102762559 100000277 rs1214293316 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802380
RSID SNP 9 102762560 100000278 rs909609628 T TA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802381
RSID SNP 9 102762560 100000278 rs962446416 TA T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802381
RSID SNP 9 102762561 100000279 rs973526442 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802382
RSID SNP 9 10000028 10000028 rs922429352 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990028
RSID SNP 9 102762571 100000289 rs922164695 T A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802392
RSID SNP 9 102762573 100000291 rs1442080293 AGGTGGGCAT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802394
RSID SNP 9 102762574 100000292 rs932220050 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802395
RSID SNP 9 102762575 100000293 rs1018521905 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802396
RSID SNP 9 102762575 100000293 rs1232207523 GTGGGCATGGTGGCACATGCC G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802396
RSID SNP 9 102762591 100000309 rs964321315 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802412
RSID SNP 9 102762597 100000315 rs1484107140 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802418
RSID SNP 9 10000033 10000033 rs996977797 A AAGATT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990033
RSID SNP 9 102762612 100000330 rs1486021781 C G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802433
RSID SNP 9 102762613 100000331 rs996244047 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802434
RSID SNP 9 102762617 100000335 rs1030003491 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802438
RSID SNP 9 102762620 100000338 rs1279568383 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802441
RSID SNP 9 102762625 100000343 rs1240557205 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802446
RSID SNP 9 102762627 100000345 rs1484776727 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802448
RSID SNP 9 102762639 100000357 rs954579432 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802460
RSID SNP 9 102762645 100000363 rs1186491505 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802466
RSID SNP 9 102762658 100000376 rs983235681 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802479
RSID SNP 9 102762664 100000382 rs571088788 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802485
RSID SNP 9 102762671 100000389 rs533643873 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802492
RSID SNP 9 102762676 100000394 rs1052448271 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802497
RSID SNP 9 102762677 100000395 rs1420175887 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802498
RSID SNP 9 102762678 100000396 rs963163949 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802499
RSID SNP 9 10000040 10000040 rs1028491957 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990040
RSID SNP 9 102762684 100000402 rs973239566 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802505
RSID SNP 9 102762685 100000403 rs1407290949 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802506
RSID SNP 9 102762686 100000404 rs1331017812 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802507
RSID SNP 9 102762689 100000407 rs1464530466 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802510
RSID SNP 9 102762690 100000408 rs927211030 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802511
RSID SNP 9 102762696 100000414 rs937261667 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802517
RSID SNP 9 102762699 100000417 rs1028189836 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802520
RSID SNP 9 10000042 10000042 rs1234450666 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990042
RSID SNP 9 102762708 100000426 rs1171511554 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802529
RSID SNP 9 10000043 10000043 rs776424340 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 9990043
RSID SNP 9 102762712 100000430 rs1472498896 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802533
RSID SNP 9 102762713 100000431 rs1367002253 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802534
RSID SNP 9 102762715 100000433 rs1394026279 A AC NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802536
RSID SNP 9 102762716 100000434 rs55813162 T A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802537
RSID SNP 9 102762716 100000434 rs1243543266 TC T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802537
RSID SNP 9 102762717 100000435 rs34304276 C CA,CAA,CAAA,CAAAA,CAAAAA,CAAAAAA,CAAAAAAA,CAAAAAAA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs1197728395 C A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs1165021757 CAAAAAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs36006872 CA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs766194694 CAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs1388677907 CAAAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs1404912702 CAAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538
RSID SNP 9 102762717 100000435 rs748789927 CA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101802538

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see