DNA Marker Index data for Chromosome: 7
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 7 1039636 1000000 rs146044506 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 1006162
RSID SNP 7 10039627 10000000 rs943518814 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006152
RSID SNP 7 99597627 100000004 rs1192451793 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435563
RSID SNP 7 99597628 100000005 rs1442930983 A C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435564
RSID SNP 7 99597630 100000007 rs1315922914 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435566
RSID SNP 7 99597631 100000008 rs928340382 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435567
RSID SNP 7 99597632 100000009 rs1055591168 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435568
RSID SNP 7 99597641 100000018 rs551938625 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435577
RSID SNP 7 99597645 100000022 rs1341983858 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435581
RSID SNP 7 99597649 100000026 rs79571451 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435585
RSID SNP 7 99597651 100000028 rs1227397620 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435587
RSID SNP 7 99597658 100000035 rs780744353 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435594
RSID SNP 7 99597663 100000040 rs1325092558 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435599
RSID SNP 7 99597665 100000042 rs1341568683 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435601
RSID SNP 7 99597665 100000042 rs572608893 C CA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435601
RSID SNP 7 99597665 100000042 rs1404629894 CAAAAAAAAAGA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435601
RSID SNP 7 99597665 100000042 rs1449870024 CA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435601
RSID SNP 7 99597666 100000043 rs185545680 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435602
RSID SNP 7 99597669 100000046 rs549416392 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435605
RSID SNP 7 99597674 100000051 rs1411281455 A AG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435610
RSID SNP 7 99597674 100000051 rs200396198 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435610
RSID SNP 7 99597675 100000052 rs75000752 G A,C,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435611
RSID SNP 7 99597675 100000052 rs141634804 G GA,GAA,GT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435611
RSID SNP 7 99597675 100000052 rs201700171 GA G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435611
RSID SNP 7 99597675 100000052 rs1205575335 GAAAAA G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435611
RSID SNP 7 99597678 100000055 rs1043005950 A G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435614
RSID SNP 7 99597681 100000058 rs941727902 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435617
RSID SNP 7 99597685 100000062 rs903094188 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435621
RSID SNP 7 99597691 100000068 rs1231083875 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435627
RSID SNP 7 99597703 100000080 rs1281547701 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435639
RSID SNP 7 99597706 100000083 rs1244340395 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435642
RSID SNP 7 99597706 100000083 rs1381477311 ATCT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435642
RSID SNP 7 99597709 100000086 rs1351669039 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435645
RSID SNP 7 99597713 100000090 rs1223622367 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435649
RSID SNP 7 99597720 100000097 rs998967350 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435656
RSID SNP 7 1039637 1000001 rs1042452626 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 1006163
RSID SNP 7 99597723 100000100 rs567624959 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435659
RSID SNP 7 99597732 100000109 rs138963362 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435668
RSID SNP 7 10039638 10000011 rs1486425825 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006163
RSID SNP 7 99597736 100000113 rs997599669 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435672
RSID SNP 7 99597738 100000115 rs1007326651 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435674
RSID SNP 7 99597741 100000118 rs556429276 T C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435677
RSID SNP 7 10039639 10000012 rs1226633777 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006164
RSID SNP 7 99597745 100000122 rs1367146217 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435681
RSID SNP 7 99597746 100000123 rs1161657801 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435682
RSID SNP 7 99597747 100000124 rs1449393630 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435683
RSID SNP 7 99597752 100000129 rs749840723 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435688
RSID SNP 7 99597759 100000136 rs1051884783 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435695
RSID SNP 7 99597759 100000136 rs1384731683 CACTTGCTATTTGCAGAGTCTGATTA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435695
RSID SNP 7 99597761 100000138 rs1183340579 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435697
RSID SNP 7 99597767 100000144 rs1364055763 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435703
RSID SNP 7 99597772 100000149 rs1017267805 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435708
RSID SNP 7 10039642 10000015 rs1344839057 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006167
RSID SNP 7 99597773 100000150 rs999600762 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435709
RSID SNP 7 99597777 100000154 rs1156436039 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435713
RSID SNP 7 99597779 100000156 rs1419797619 T TA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435715
RSID SNP 7 99597780 100000157 rs1032872101 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435716
RSID SNP 7 10039643 10000016 rs569646207 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006168
RSID SNP 7 99597787 100000164 rs1181272425 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435723
RSID SNP 7 99597793 100000170 rs1490618579 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435729
RSID SNP 7 99597807 100000184 rs1294383484 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435743
RSID SNP 7 99597811 100000188 rs1220985184 AC A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435747
RSID SNP 7 99597813 100000190 rs143621001 C CT,CTT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435749
RSID SNP 7 99597813 100000190 rs1370455504 CTTT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435749
RSID SNP 7 99597813 100000190 rs1225000621 CT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435749
RSID SNP 7 99597814 100000191 rs958058088 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435750
RSID SNP 7 1039638 1000002 rs1450767503 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 1006164
RSID SNP 7 10039647 10000020 rs1199086109 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006172
RSID SNP 7 99597826 100000203 rs77230030 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435762
RSID SNP 7 99597829 100000206 rs1164142616 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435765
RSID SNP 7 99597830 100000207 rs1388470163 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435766
RSID SNP 7 99597831 100000208 rs1385231313 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435767
RSID SNP 7 99597834 100000211 rs1330942720 A C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435770
RSID SNP 7 99597845 100000222 rs1347244132 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435781
RSID SNP 7 99597846 100000223 rs1301032162 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435782
RSID SNP 7 99597853 100000230 rs1012294181 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435789
RSID SNP 7 99597854 100000231 rs1336628767 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435790
RSID SNP 7 99597865 100000242 rs571705756 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435801
RSID SNP 7 99597872 100000249 rs1402523635 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435808
RSID SNP 7 10039652 10000025 rs1039477364 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10006177
RSID SNP 7 99597873 100000250 rs539283182 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435809
RSID SNP 7 99597878 100000255 rs557500458 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435814
RSID SNP 7 99597879 100000256 rs919546192 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435815
RSID SNP 7 99597884 100000261 rs1271547258 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435820
RSID SNP 7 99597896 100000273 rs1337415985 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435832
RSID SNP 7 99597902 100000279 rs71530305 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435838
RSID SNP 7 99597903 100000280 rs981244514 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435839
RSID SNP 7 99597913 100000290 rs187871921 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435849
RSID SNP 7 99597921 100000298 rs779806554 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435857
RSID SNP 7 99597922 100000299 rs1273176551 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435858
RSID SNP 7 99597924 100000301 rs367928940 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435860
RSID SNP 7 99597934 100000311 rs1354820261 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435870
RSID SNP 7 99597935 100000312 rs1282938459 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435871
RSID SNP 7 99597937 100000314 rs748982968 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435873
RSID SNP 7 99597938 100000315 rs950632156 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435874
RSID SNP 7 99597942 100000319 rs982548367 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435878
RSID SNP 7 99597947 100000324 rs927998495 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435883
RSID SNP 7 99597949 100000326 rs1362309919 A AT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435885
RSID SNP 7 99597955 100000332 rs769113562 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435891
RSID SNP 7 99597956 100000333 rs1055219630 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435892
RSID SNP 7 99597956 100000333 rs1343576892 CCTGCCGCCACACTCGGCTAAGT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99435892

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see