DNA Marker Index data for Chromosome: 5
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 5 99335705 100000001 rs1411921275 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363604
RSID SNP 5 99335711 100000007 rs1272324943 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363610
RSID SNP 5 10000113 10000001 rs443601 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053113
RSID SNP 5 99335714 100000010 rs1015051799 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363613
RSID SNP 5 99335721 100000017 rs1451764797 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363620
RSID SNP 5 99335726 100000022 rs1351293608 CACTT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363625
RSID SNP 5 99335732 100000028 rs897904105 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363631
RSID SNP 5 99335743 100000039 rs1312462158 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363642
RSID SNP 5 99335748 100000044 rs965816088 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363647
RSID SNP 5 99335754 100000050 rs1404441982 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363653
RSID SNP 5 99335756 100000052 rs1223354298 A AAGTAACAC NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363655
RSID SNP 5 99335756 100000052 rs1173680887 ATTC A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363655
RSID SNP 5 99335758 100000054 rs1240040287 T TA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363657
RSID SNP 5 99335760 100000056 rs1474779883 A ATCTG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363659
RSID SNP 5 99335761 100000057 rs1193821178 A ATTACTTATAAGTCTTATAAG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363660
RSID SNP 5 99335761 100000057 rs1453607785 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363660
RSID SNP 5 99335762 100000058 rs1410246510 T A,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363661
RSID SNP 5 10000118 10000006 rs564707299 G C,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053118
RSID SNP 5 99335771 100000067 rs975933512 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363670
RSID SNP 5 99335771 100000067 rs1322357442 GTC G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363670
RSID SNP 5 99335772 100000068 rs1252153371 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363671
RSID SNP 5 99335774 100000070 rs1186384711 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363673
RSID SNP 5 99335775 100000071 rs535103737 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363674
RSID SNP 5 99335783 100000079 rs1030737115 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363682
RSID SNP 5 99335799 100000095 rs1200975281 T TG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363698
RSID SNP 5 99335799 100000095 rs553629638 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363698
RSID SNP 5 99335800 100000096 rs1328327063 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363699
RSID SNP 5 99335803 100000099 rs1477670 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363702
RSID SNP 5 10000122 10000010 rs942800007 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053122
RSID SNP 5 10000122 10000010 rs1385473940 GAC G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053122
RSID SNP 5 99335808 100000104 rs1164587290 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363707
RSID SNP 5 99335814 100000110 rs1477669 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363713
RSID SNP 5 99335815 100000111 rs953602755 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363714
RSID SNP 5 99335818 100000114 rs957282620 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363717
RSID SNP 5 10000124 10000012 rs447733 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053124
RSID SNP 5 99335835 100000131 rs989975615 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363734
RSID SNP 5 99335840 100000136 rs1477668 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363739
RSID SNP 5 99335841 100000137 rs554704534 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363740
RSID SNP 5 99335849 100000145 rs1382189702 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363748
RSID SNP 5 99335859 100000155 rs1387145846 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363758
RSID SNP 5 99335862 100000158 rs1323113659 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363761
RSID SNP 5 99335864 100000160 rs917692500 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363763
RSID SNP 5 99335872 100000168 rs981242133 C G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363771
RSID SNP 5 99335874 100000170 rs770654787 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363773
RSID SNP 5 99335875 100000171 rs936999246 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363774
RSID SNP 5 99335884 100000180 rs575198364 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363783
RSID SNP 5 99335891 100000187 rs139712173 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363790
RSID SNP 5 99335892 100000188 rs1328796549 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363791
RSID SNP 5 99335899 100000195 rs1342225952 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363798
RSID SNP 5 10000132 10000020 rs1267466968 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053132
RSID SNP 5 99335916 100000212 rs1037189825 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363815
RSID SNP 5 10000134 10000022 rs534854066 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053134
RSID SNP 5 99335926 100000222 rs1477666 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363825
RSID SNP 5 99335936 100000232 rs942318966 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363835
RSID SNP 5 99335948 100000244 rs1356743841 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363847
RSID SNP 5 99335964 100000260 rs1036484225 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363863
RSID SNP 5 99335966 100000262 rs898028352 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363865
RSID SNP 5 99335969 100000265 rs1211463148 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363868
RSID SNP 5 99335989 100000285 rs142031319 C G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363888
RSID SNP 5 99335996 100000292 rs1051835210 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363895
RSID SNP 5 99335999 100000295 rs758489891 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363898
RSID SNP 5 99336012 100000308 rs889204625 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363911
RSID SNP 5 99336014 100000310 rs1284972070 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363913
RSID SNP 5 99336015 100000311 rs890002400 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363914
RSID SNP 5 99336017 100000313 rs1007525599 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363916
RSID SNP 5 99336018 100000314 rs1006907585 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363917
RSID SNP 5 99336019 100000315 rs1032792008 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363918
RSID SNP 5 99336020 100000316 rs1321932535 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363919
RSID SNP 5 99336023 100000319 rs965516256 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363922
RSID SNP 5 99336024 100000320 rs1010315135 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363923
RSID SNP 5 99336028 100000324 rs957272643 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363927
RSID SNP 5 99336034 100000330 rs1163451160 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363933
RSID SNP 5 10000146 10000034 rs1226388050 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053146
RSID SNP 5 99336047 100000343 rs1448408064 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363946
RSID SNP 5 99336048 100000344 rs1011525153 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363947
RSID SNP 5 99336051 100000347 rs1190452993 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363950
RSID SNP 5 99336055 100000351 rs1020115520 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363954
RSID SNP 5 99336062 100000358 rs1245946280 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363961
RSID SNP 5 99336069 100000365 rs1473967180 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363968
RSID SNP 5 99336070 100000366 rs967173571 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363969
RSID SNP 5 10000149 10000037 rs182812107 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053149
RSID SNP 5 99336086 100000382 rs539918702 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363985
RSID SNP 5 99336087 100000383 rs981699548 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363986
RSID SNP 5 99336091 100000387 rs928364372 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363990
RSID SNP 5 10000151 10000039 rs1341972392 C CA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053151
RSID SNP 5 99336095 100000391 rs1157253413 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99363994
RSID SNP 5 99336105 100000401 rs777650682 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364004
RSID SNP 5 99336109 100000405 rs1367465960 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364008
RSID SNP 5 99336122 100000418 rs35212700 AAAT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364021
RSID SNP 5 99336128 100000424 rs1439106681 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364027
RSID SNP 5 99336131 100000427 rs1332024845 T C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364030
RSID SNP 5 99336132 100000428 rs146346496 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364031
RSID SNP 5 99336135 100000431 rs1368193063 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364034
RSID SNP 5 99336141 100000437 rs1169898316 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364040
RSID SNP 5 10000156 10000044 rs1297524892 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053156
RSID SNP 5 99336154 100000450 rs5869884 C CA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364053
RSID SNP 5 99336154 100000450 rs1429791977 CAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364053
RSID SNP 5 99336160 100000456 rs771120626 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364059
RSID SNP 5 99336162 100000458 rs1189384918 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364061
RSID SNP 5 10000158 10000046 rs901139187 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10053158
RSID SNP 5 99336168 100000464 rs1478925873 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99364067

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see