DNA Marker Index data for Chromosome: 3
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 3 99718844 100000000 rs1469272243 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201534
RSID SNP 3 99718846 100000002 rs1004485250 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201536
RSID SNP 3 10041685 10000001 rs1484321525 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016685
RSID SNP 3 99718854 100000010 rs1015683422 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201544
RSID SNP 3 99718859 100000015 rs758421174 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201549
RSID SNP 3 99718863 100000019 rs572632152 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201553
RSID SNP 3 10041686 10000002 rs910022516 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016686
RSID SNP 3 99718865 100000021 rs539938173 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201555
RSID SNP 3 99718867 100000023 rs995178305 A C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201557
RSID SNP 3 99718869 100000025 rs1028025807 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201559
RSID SNP 3 99718875 100000031 rs149859510 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201565
RSID SNP 3 99718883 100000039 rs986857759 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201573
RSID SNP 3 99718890 100000046 rs967951647 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201580
RSID SNP 3 99718891 100000047 rs751391534 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201581
RSID SNP 3 10041689 10000005 rs942960671 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016689
RSID SNP 3 99718896 100000052 rs967007248 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201586
RSID SNP 3 99718897 100000053 rs1408217739 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201587
RSID SNP 3 99718899 100000055 rs1221954164 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201589
RSID SNP 3 99718901 100000057 rs1490617631 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201591
RSID SNP 3 99718902 100000058 rs1294398877 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201592
RSID SNP 3 99718905 100000061 rs1399940626 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201595
RSID SNP 3 99718905 100000061 rs1222622301 AT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201595
RSID SNP 3 99718906 100000062 rs978017164 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201596
RSID SNP 3 99718916 100000072 rs1350564441 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201606
RSID SNP 3 99718917 100000073 rs573741845 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201607
RSID SNP 3 99718918 100000074 rs979181190 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201608
RSID SNP 3 99718922 100000078 rs1302160212 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201612
RSID SNP 3 99718925 100000081 rs1405105418 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201615
RSID SNP 3 99718931 100000087 rs925939700 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201621
RSID SNP 3 99718933 100000089 rs1315942225 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201623
RSID SNP 3 99718935 100000091 rs1396645629 T C,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201625
RSID SNP 3 99718936 100000092 rs1408579658 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201626
RSID SNP 3 141683 100000 rs1036100013 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 116683
RSID SNP 3 99718937 100000093 rs544183788 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201627
RSID SNP 3 99718938 100000094 rs925073767 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201628
RSID SNP 3 99718942 100000098 rs1473623702 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201632
RSID SNP 3 99718949 100000105 rs936494078 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201639
RSID SNP 3 99718952 100000108 rs990693245 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201642
RSID SNP 3 10041695 10000011 rs1366846146 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016695
RSID SNP 3 99718954 100000110 rs754856384 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201644
RSID SNP 3 99718962 100000118 rs948862324 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201652
RSID SNP 3 99718964 100000120 rs1214052124 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201654
RSID SNP 3 99718975 100000131 rs1446744441 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201665
RSID SNP 3 99718978 100000134 rs1285600577 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201668
RSID SNP 3 99718979 100000135 rs1348271468 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201669
RSID SNP 3 99718987 100000143 rs1320801063 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201677
RSID SNP 3 99718992 100000148 rs922666497 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201682
RSID SNP 3 99718993 100000149 rs1223806009 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201683
RSID SNP 3 10041699 10000015 rs1292991583 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016699
RSID SNP 3 99718999 100000155 rs1346977541 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201689
RSID SNP 3 10041700 10000016 rs1180179840 T TTTG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016700
RSID SNP 3 10041700 10000016 rs1456516895 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016700
RSID SNP 3 10041700 10000016 rs1429358195 TTTGTTG T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016700
RSID SNP 3 10041700 10000016 rs1164387808 TTTG T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016700
RSID SNP 3 99719004 100000160 rs1268235579 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201694
RSID SNP 3 99719006 100000162 rs1444460045 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201696
RSID SNP 3 99719007 100000163 rs934198746 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201697
RSID SNP 3 99719012 100000168 rs1046119863 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201702
RSID SNP 3 99719013 100000169 rs1320214702 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201703
RSID SNP 3 99719015 100000171 rs1468166560 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201705
RSID SNP 3 99719021 100000177 rs907212112 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201711
RSID SNP 3 99719025 100000181 rs562775234 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201715
RSID SNP 3 99719026 100000182 rs992302382 CCTTCTTCTGATCCTTCAGG C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201716
RSID SNP 3 99719030 100000186 rs1175774257 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201720
RSID SNP 3 99719035 100000191 rs1470449192 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201725
RSID SNP 3 99719040 100000196 rs187072617 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201730
RSID SNP 3 99719042 100000198 rs1184952908 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201732
RSID SNP 3 1041686 1000002 rs545081518 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 1016686
RSID SNP 3 99719045 100000201 rs1475299367 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201735
RSID SNP 3 10041705 10000021 rs1388669413 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016705
RSID SNP 3 99719055 100000211 rs1372847334 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201745
RSID SNP 3 99719063 100000219 rs1191124584 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201753
RSID SNP 3 10041706 10000022 rs1232678521 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016706
RSID SNP 3 99719067 100000223 rs1460359835 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201757
RSID SNP 3 99719082 100000238 rs940231228 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201772
RSID SNP 3 99719083 100000239 rs904826058 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201773
RSID SNP 3 99719093 100000249 rs1336124044 CTTTTTGTAGG C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201783
RSID SNP 3 10041709 10000025 rs1039891289 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016709
RSID SNP 3 99719105 100000261 rs1037245456 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201795
RSID SNP 3 99719110 100000266 rs114141441 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201800
RSID SNP 3 99719113 100000269 rs1271702871 A G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201803
RSID SNP 3 99719121 100000277 rs995624513 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201811
RSID SNP 3 99719122 100000278 rs1337266571 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201812
RSID SNP 3 10041712 10000028 rs1267313689 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016712
RSID SNP 3 99719125 100000281 rs1028475693 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201815
RSID SNP 3 99719130 100000286 rs889514767 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201820
RSID SNP 3 99719130 100000286 rs1470357003 C CT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201820
RSID SNP 3 99719137 100000293 rs560484183 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201827
RSID SNP 3 99719141 100000297 rs1168605974 TC T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201831
RSID SNP 3 10041714 10000030 rs367759629 T TG NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016714
RSID SNP 3 99719144 100000300 rs1009439107 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201834
RSID SNP 3 99719150 100000306 rs1233119422 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201840
RSID SNP 3 99719164 100000320 rs780686420 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201854
RSID SNP 3 99719169 100000325 rs1179756790 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201859
RSID SNP 3 10041718 10000034 rs900201933 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016718
RSID SNP 3 99719190 100000346 rs1007996593 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201880
RSID SNP 3 99719192 100000348 rs1019669958 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201882
RSID SNP 3 99719206 100000362 rs747874940 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201896
RSID SNP 3 10041721 10000037 rs997580462 A AT NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016721
RSID SNP 3 99719215 100000371 rs1388449184 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 101201905
RSID SNP 3 10041722 10000038 rs1268988575 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10016722

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see