DNA Marker Index data for Chromosome: 22
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 22 9421837 10510077 rs1290354662 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421865 10510105 rs1325858619 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421873 10510113 rs1435837414 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421882 10510122 rs1390939932 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421893 10510133 rs1287261688 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421924 10510164 rs1453321352 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421931 10510171 rs1378487509 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421953 10510193 rs1177947504 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421972 10510212 rs1452389754 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421984 10510224 rs1394361776 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421987 10510227 rs1189169154 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421988 10510228 rs1465816077 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421992 10510232 rs1259049851 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421993 10510233 rs1204097577 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421995 10510235 rs1483360299 C A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9421998 10510238 rs1236895259 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422010 10510250 rs1346191549 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422018 10510258 rs1303237001 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422021 10510261 rs1229791162 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422037 10510277 rs1328776741 AAGTGGGCGGATCACTTGAGGTCAGG A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422045 10510285 rs1316299970 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422046 10510286 rs1381775204 G A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422052 10510292 rs1304841723 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422065 10510305 rs1432579666 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422103 10510343 rs1374641869 CTAA C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422111 10510351 rs1169068757 AAT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422112 10510352 rs1451237815 AT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422113 10510353 rs1371313213 T TA NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422115 10510355 rs1191806540 AT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422116 10510356 rs1423921207 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422116 10510356 rs1257770179 T TA,TAAA NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422116 10510356 rs1484855651 TA T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422119 10510359 rs1280057286 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422122 10510362 rs1206393380 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422133 10510373 rs1342062983 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422184 10510424 rs1268976573 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422194 10510434 rs1226737928 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422197 10510437 rs1341166184 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422198 10510438 rs1295291701 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422205 10510445 rs1413175681 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422234 10510474 rs1355124461 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422237 10510477 rs1308385861 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422249 10510489 rs1411491256 TG T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422250 10510490 rs1394199713 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422251 10510491 rs1167281203 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422257 10510497 rs1457915203 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422271 10510511 rs1369699122 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422278 10510518 rs1185246552 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422278 10510518 rs1474670173 GA G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422280 10510519 rs1252157418 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422282 10510521 rs1183314673 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422290 10510529 rs1439955745 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422291 10510530 rs1271442173 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422293 10510532 rs1195748497 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422294 10510533 rs1357063325 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422306 10510545 rs1275123423 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422324 10510563 rs1231581727 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422327 10510566 rs1355026138 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422330 10510569 rs1289251514 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422358 10510597 rs1444047028 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422361 10510600 rs1333778199 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422374 10510613 rs1328017531 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422381 10510620 rs1387270575 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422384 10510623 rs1396670584 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422385 10510624 rs1162147936 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422387 10510626 rs1460505479 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422389 10510628 rs1412205648 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422390 10510629 rs1160962170 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422392 10510631 rs1471329167 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422401 10510640 rs1231535245 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422403 10510642 rs1181626779 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422414 10510653 rs1452669264 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422416 10510655 rs1255485891 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422419 10510658 rs1211851261 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422422 10510661 rs1334289445 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422424 10510663 rs1268934102 AT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422444 10510683 rs1225684459 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422467 10510706 rs1348888066 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422473 10510712 rs1278722658 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422474 10510713 rs1233771970 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422479 10510718 rs1373058970 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422499 10510738 rs1323847395 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422511 10510750 rs1439463407 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422520 10510759 rs1388748370 AGAAAGAAATTCAAAATAAAATT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422531 10510770 rs71207739 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422541 10510780 rs1398592173 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422566 10510805 rs1406870635 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422590 10510829 rs1158320104 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422591 10510830 rs1455004156 TA T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422601 10510840 rs1397374157 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422610 10510849 rs1192321747 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422614 10510853 rs1468035162 T A,G NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422615 10510854 rs1218106404 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422617 10510856 rs1445470910 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422637 10510876 rs1283878263 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422644 10510883 rs1200783815 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422652 10510891 rs1349818895 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422656 10510895 rs1301086662 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422667 10510906 rs1233485658 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422668 10510907 rs1365930448 T A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-
RSID SNP 22 9422670 10510909 rs1428085552 AT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: -not mapped-

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see