DNA Marker Index data for Chromosome: 2
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 2 10140128 10000000 rs1204177737 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057579
RSID SNP 2 100616465 100000003 rs770475061 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982897
RSID SNP 2 100616473 100000011 rs1470283977 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982905
RSID SNP 2 100616475 100000013 rs780892317 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982907
RSID SNP 2 100616476 100000014 rs908029300 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982908
RSID SNP 2 100616489 100000027 rs1196898041 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982921
RSID SNP 2 100616496 100000034 rs548754456 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982928
RSID SNP 2 100616497 100000035 rs1389226045 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982929
RSID SNP 2 100616498 100000036 rs1271586344 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982930
RSID SNP 2 100616502 100000040 rs1437230320 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982934
RSID SNP 2 100616511 100000049 rs1223788972 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982943
RSID SNP 2 100616517 100000055 rs1040823603 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982949
RSID SNP 2 100616519 100000057 rs1334376128 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982951
RSID SNP 2 100616520 100000058 rs565564265 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982952
RSID SNP 2 100616524 100000062 rs996150884 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982956
RSID SNP 2 100616528 100000066 rs533999951 A G,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982960
RSID SNP 2 100616530 100000068 rs1050437031 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982962
RSID SNP 2 100616532 100000070 rs1347160454 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982964
RSID SNP 2 100616533 100000071 rs893166817 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982965
RSID SNP 2 100616551 100000089 rs1010819548 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982983
RSID SNP 2 100616551 100000089 rs1347886450 CAT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982983
RSID SNP 2 100616553 100000091 rs1324646665 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982985
RSID SNP 2 100616555 100000093 rs1222762859 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982987
RSID SNP 2 100616560 100000098 rs1400758185 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99982992
RSID SNP 2 100616571 100000109 rs553861563 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983003
RSID SNP 2 100616574 100000112 rs528708445 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983006
RSID SNP 2 100616581 100000119 rs13392668 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983013
RSID SNP 2 100616586 100000124 rs999373638 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983018
RSID SNP 2 100616591 100000129 rs1465709018 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983023
RSID SNP 2 100616592 100000130 rs979136317 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983024
RSID SNP 2 100616595 100000133 rs1470754170 CTATT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983027
RSID SNP 2 10140142 10000014 rs1339559150 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057593
RSID SNP 2 100616620 100000158 rs745496795 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983052
RSID SNP 2 100616622 100000160 rs114587630 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983054
RSID SNP 2 100616623 100000161 rs556329675 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983055
RSID SNP 2 100616625 100000163 rs766974435 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983057
RSID SNP 2 100616628 100000166 rs1200630271 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983060
RSID SNP 2 100616632 100000170 rs1461190909 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983064
RSID SNP 2 100616635 100000173 rs1188501054 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983067
RSID SNP 2 100616654 100000192 rs1240833156 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983086
RSID SNP 2 100616657 100000195 rs1196020698 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983089
RSID SNP 2 10140148 10000020 rs529941304 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057599
RSID SNP 2 100616663 100000201 rs1447644487 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983095
RSID SNP 2 100616665 100000203 rs953710409 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983097
RSID SNP 2 100616668 100000206 rs990551737 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983100
RSID SNP 2 100616674 100000212 rs1201935625 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983106
RSID SNP 2 100616677 100000215 rs1325948984 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983109
RSID SNP 2 100616678 100000216 rs1263479818 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983110
RSID SNP 2 10140150 10000022 rs971100399 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057601
RSID SNP 2 100616682 100000220 rs372893192 AGCTCAAATCTTGTTGATTTAGT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983114
RSID SNP 2 10140151 10000023 rs764589147 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057602
RSID SNP 2 100616694 100000232 rs1468647721 GTTGA G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983126
RSID SNP 2 100616695 100000233 rs1158026643 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983127
RSID SNP 2 100616699 100000237 rs1271842318 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983131
RSID SNP 2 100616700 100000238 rs1431475207 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983132
RSID SNP 2 100616701 100000239 rs1428667423 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983133
RSID SNP 2 10140152 10000024 rs1281947359 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057603
RSID SNP 2 100616703 100000241 rs1412802405 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983135
RSID SNP 2 100616704 100000242 rs1334138512 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983136
RSID SNP 2 100616708 100000246 rs1454205315 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983140
RSID SNP 2 10140153 10000025 rs1446410932 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057604
RSID SNP 2 100616729 100000267 rs1406401692 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983161
RSID SNP 2 100616731 100000269 rs916233234 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983163
RSID SNP 2 10140155 10000027 rs1357926446 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057606
RSID SNP 2 100616732 100000270 rs1174262601 CAT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983164
RSID SNP 2 100616738 100000276 rs749040875 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983170
RSID SNP 2 100616749 100000287 rs1409729301 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983181
RSID SNP 2 100616751 100000289 rs985446766 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983183
RSID SNP 2 100616753 100000291 rs1170146098 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983185
RSID SNP 2 100616757 100000295 rs1476032035 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983189
RSID SNP 2 100616763 100000301 rs1405081676 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983195
RSID SNP 2 100616768 100000306 rs1396433943 G GA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983200
RSID SNP 2 100616769 100000307 rs1335760665 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983201
RSID SNP 2 100616774 100000312 rs1181853423 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983206
RSID SNP 2 100616775 100000313 rs1333577951 CAAAT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983207
RSID SNP 2 100616780 100000318 rs576664227 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983212
RSID SNP 2 100616780 100000318 rs1243948190 AC A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983212
RSID SNP 2 100616781 100000319 rs1204158633 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983213
RSID SNP 2 100616782 100000320 rs908123294 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983214
RSID SNP 2 100616783 100000321 rs939882173 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983215
RSID SNP 2 100616791 100000329 rs542192337 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983223
RSID SNP 2 100616797 100000335 rs768346581 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983229
RSID SNP 2 100616798 100000336 rs535362769 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983230
RSID SNP 2 10140162 10000034 rs1313810930 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057613
RSID SNP 2 100616802 100000340 rs919739980 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983234
RSID SNP 2 100616811 100000349 rs923328497 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983243
RSID SNP 2 10140163 10000035 rs1189143088 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057614
RSID SNP 2 100616821 100000359 rs1382949566 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983253
RSID SNP 2 100616831 100000369 rs879704543 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983263
RSID SNP 2 100616834 100000372 rs1261883663 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983266
RSID SNP 2 100616836 100000374 rs1344715241 G A,C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983268
RSID SNP 2 100616840 100000378 rs932036681 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983272
RSID SNP 2 100616841 100000379 rs553406107 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983273
RSID SNP 2 100616844 100000382 rs374602690 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983276
RSID SNP 2 100616845 100000383 rs1430905228 C CA NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983277
RSID SNP 2 100616859 100000397 rs1385120214 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983291
RSID SNP 2 10140168 10000040 rs1409590428 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 10057619
RSID SNP 2 100616862 100000400 rs761723502 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983294
RSID SNP 2 100616863 100000401 rs893138900 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983295
RSID SNP 2 100616864 100000402 rs1386010192 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983296
RSID SNP 2 100616866 100000404 rs189846401 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 99983298

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome



Also see