DNA Marker Index data for Chromosome: 15
Type Chromosome Position (hg19)1 Position (hg38)2 Marker Name(s) (separated with a single space) Anc2 Alt Source Notes
RSID SNP 15 100540206 100000001 rs1338738137 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357729
RSID SNP 15 100540209 100000004 rs1246086369 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357732
RSID SNP 15 100540211 100000006 rs990697389 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357734
RSID SNP 15 100540214 100000009 rs924930355 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357737
RSID SNP 15 100540216 100000011 rs1384165938 AG A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357739
RSID SNP 15 100540218 100000013 rs1296336286 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357741
RSID SNP 15 100540222 100000017 rs915102740 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357745
RSID SNP 15 100540234 100000029 rs932456405 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357757
RSID SNP 15 100540239 100000034 rs1360981351 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357762
RSID SNP 15 100540241 100000036 rs1162495854 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357764
RSID SNP 15 100540242 100000037 rs1388862689 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357765
RSID SNP 15 100540243 100000038 rs1049935509 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357766
RSID SNP 15 100540244 100000039 rs890847677 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357767
RSID SNP 15 100540245 100000040 rs1168982692 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357768
RSID SNP 15 100540247 100000042 rs78351996 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357770
RSID SNP 15 100540252 100000047 rs1427480292 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357775
RSID SNP 15 100540260 100000055 rs1263091625 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357783
RSID SNP 15 100540261 100000056 rs1456005310 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357784
RSID SNP 15 100540265 100000060 rs117617126 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357788
RSID SNP 15 100540270 100000065 rs898095569 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357793
RSID SNP 15 100540278 100000073 rs933992065 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357801
RSID SNP 15 100540281 100000076 rs993739873 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357804
RSID SNP 15 100540282 100000077 rs1433668863 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357805
RSID SNP 15 100540285 100000080 rs1027682863 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357808
RSID SNP 15 100540286 100000081 rs1267227317 GTGTC G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357809
RSID SNP 15 100540289 100000084 rs1245606365 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357812
RSID SNP 15 100540294 100000089 rs148557397 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357817
RSID SNP 15 100540298 100000093 rs952024848 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357821
RSID SNP 15 100540300 100000095 rs1276196110 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357823
RSID SNP 15 100540304 100000099 rs1051064729 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357827
RSID SNP 15 100540307 100000102 rs889781543 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357830
RSID SNP 15 100540308 100000103 rs533290740 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357831
RSID SNP 15 100540310 100000105 rs1403176812 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357833
RSID SNP 15 100540311 100000106 rs942966342 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357834
RSID SNP 15 100540321 100000116 rs186528396 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357844
RSID SNP 15 100540328 100000123 rs898689326 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357851
RSID SNP 15 100540329 100000124 rs960797069 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357852
RSID SNP 15 100540333 100000128 rs994314994 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357856
RSID SNP 15 100540337 100000132 rs1192080275 TGTCATTGTCTCCTTGGTAGGAGA T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357860
RSID SNP 15 100540342 100000137 rs1047949990 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357865
RSID SNP 15 100540344 100000139 rs1264277935 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357867
RSID SNP 15 100540349 100000144 rs1266145789 CT C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357872
RSID SNP 15 100540361 100000156 rs547849136 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357884
RSID SNP 15 100540367 100000162 rs913724783 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357890
RSID SNP 15 100540372 100000167 rs1450310697 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357895
RSID SNP 15 100540376 100000171 rs765542362 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357899
RSID SNP 15 100540380 100000175 rs1292275492 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357903
RSID SNP 15 100540385 100000180 rs1210714543 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357908
RSID SNP 15 100540388 100000183 rs1317336547 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357911
RSID SNP 15 100540392 100000187 rs1003625153 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357915
RSID SNP 15 100540393 100000188 rs189861863 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357916
RSID SNP 15 100540402 100000197 rs966621664 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357925
RSID SNP 15 100540404 100000199 rs1266232083 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357927
RSID SNP 15 100540414 100000209 rs1274256419 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357937
RSID SNP 15 100540417 100000212 rs979314647 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357940
RSID SNP 15 100540421 100000216 rs546686444 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357944
RSID SNP 15 100540427 100000222 rs1186898752 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357950
RSID SNP 15 100540430 100000225 rs1323777103 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357953
RSID SNP 15 100540432 100000227 rs932316903 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357955
RSID SNP 15 100540439 100000234 rs59601746 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357962
RSID SNP 15 100540442 100000237 rs1172212193 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357965
RSID SNP 15 100540446 100000241 rs1421719714 ACATTTCTCCTAGTT A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357969
RSID SNP 15 100540447 100000242 rs1012139800 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357970
RSID SNP 15 100540448 100000243 rs1368660641 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357971
RSID SNP 15 100540452 100000247 rs1477231878 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357975
RSID SNP 15 100540454 100000249 rs141647494 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357977
RSID SNP 15 100540469 100000264 rs181132301 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357992
RSID SNP 15 100540471 100000266 rs967866600 A C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357994
RSID SNP 15 100540472 100000267 rs764412684 G C,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357995
RSID SNP 15 100540476 100000271 rs924023333 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98357999
RSID SNP 15 100540477 100000272 rs1040595487 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358000
RSID SNP 15 100540484 100000279 rs955522687 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358007
RSID SNP 15 100540486 100000281 rs1277806013 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358009
RSID SNP 15 100540497 100000292 rs987282102 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358020
RSID SNP 15 100540509 100000304 rs911254547 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358032
RSID SNP 15 100540511 100000306 rs752052657 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358034
RSID SNP 15 100540512 100000307 rs897979470 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358035
RSID SNP 15 100540517 100000312 rs942659315 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358040
RSID SNP 15 100540524 100000319 rs1333028604 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358047
RSID SNP 15 100540532 100000327 rs1446865012 C A,T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358055
RSID SNP 15 100540534 100000329 rs1334048900 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358057
RSID SNP 15 100540536 100000331 rs761364259 TTTAAG T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358059
RSID SNP 15 100540546 100000341 rs1038652152 C A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358069
RSID SNP 15 100540549 100000344 rs1173537915 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358072
RSID SNP 15 100540552 100000347 rs993791460 T C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358075
RSID SNP 15 100540555 100000350 rs920148100 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358078
RSID SNP 15 100540556 100000351 rs1378686504 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358079
RSID SNP 15 100540558 100000353 rs930137367 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358081
RSID SNP 15 100540559 100000354 rs1047190207 C G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358082
RSID SNP 15 100540564 100000359 rs1049346942 G C NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358087
RSID SNP 15 100540567 100000362 rs887989208 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358090
RSID SNP 15 100540568 100000363 rs534848450 G T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358091
RSID SNP 15 100540575 100000370 rs1207873518 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358098
RSID SNP 15 100540578 100000373 rs1002632679 T A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358101
RSID SNP 15 100540579 100000374 rs764016761 G A NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358102
RSID SNP 15 100540584 100000379 rs1215618816 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358107
RSID SNP 15 100540586 100000381 rs553153805 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358109
RSID SNP 15 100540596 100000391 rs1398125448 C T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358119
RSID SNP 15 100540597 100000392 rs1313768843 A G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358120
RSID SNP 15 100540599 100000394 rs1033654469 T G NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358122
RSID SNP 15 100540608 100000403 rs1240473306 A T NIH DBSNP VCF b151 GRCh38p7 Position hg18: 98358131

Record Size Limit: Only the top 1000 records shown. However more markers are available when querying by marker name or position.

Count of Markers by Type and Chromosome

Also see